View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11294_low_40 (Length: 232)
Name: NF11294_low_40
Description: NF11294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11294_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 42 - 223
Target Start/End: Complemental strand, 4116889 - 4116708
Alignment:
| Q |
42 |
taattaataataatatgcatgctaaatgacgtagttgatggaaacaaagagctcaacagctctattgaaaggtaatatttagtacacttgagattcaatg |
141 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
4116889 |
taattaataataatacgcatgctaaatgacgtagttgatggaaacaaagagctcaacaactctattgaaaggtcatatttagtacacttgaaattcaatg |
4116790 |
T |
|
| Q |
142 |
ttgtaaagtgtaccataagagataagagacacatatcacgagtatatcgtgcgtctgtcataagttggaaccaaaattattc |
223 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4116789 |
ttgtaaagtgtaccataagagataagatgcacatatcacgagtatatcgtgcgtctgtgataagttggaaccaaaattattc |
4116708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University