View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11294_low_41 (Length: 229)
Name: NF11294_low_41
Description: NF11294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11294_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 7 - 224
Target Start/End: Complemental strand, 44625934 - 44625715
Alignment:
| Q |
7 |
aaattgatcgttcgatttagaaagtgcttaggtatatatccactctgatcacattt-ataag-aaaaaataacttcttagatccattgattaatctattt |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||| ||||||||| ||||| |||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
44625934 |
aaattgatcgttcgatttaaaaagtgcttaggtatatactcactctcatcacattttataagcaaaaaataactttttagattcattgattaatctattt |
44625835 |
T |
|
| Q |
105 |
ggtttacaatatagactaaatacattataatttccttgtgtcatatcatgtaaacaatgactgtgtaccctatttcgttgcttcaaaaacaaatcacaac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44625834 |
ggtttacaatatagactaaatacattataatttccttgtgtcatatcatgtaaacaatgattgtgtaccctatttcgttgcttcaaaaacaaatcacaac |
44625735 |
T |
|
| Q |
205 |
cttaagtaaacccctaaagc |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44625734 |
cttaagtaaacccctaaagc |
44625715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 148 - 221
Target Start/End: Original strand, 23303550 - 23303625
Alignment:
| Q |
148 |
tatcatgtaaacaatgactgtgtaccctatttcgttgcttcaa--aaacaaatcacaaccttaagtaaacccctaa |
221 |
Q |
| |
|
|||||||||||||| | | |||||||| ||| |||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
23303550 |
tatcatgtaaacaaaaattatgtaccctgttttgttgcttcaaggaatcaaatcacaaccttaagtaaacccctaa |
23303625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 53 - 86
Target Start/End: Complemental strand, 28499916 - 28499883
Alignment:
| Q |
53 |
gatcacatttataagaaaaaataacttcttagat |
86 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
28499916 |
gatcacatttataagaaaaaataactttttagat |
28499883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 94 - 130
Target Start/End: Complemental strand, 38173506 - 38173470
Alignment:
| Q |
94 |
ttaatctatttggtttacaatatagactaaatacatt |
130 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
38173506 |
ttaatgtatttggtttataatatagactaaatacatt |
38173470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University