View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11295_low_5 (Length: 215)
Name: NF11295_low_5
Description: NF11295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11295_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 12 - 197
Target Start/End: Complemental strand, 7684259 - 7684073
Alignment:
| Q |
12 |
agatgaagcaatagcatggataattaagatatctataatgaatgcatgcattaaaagacgattaaatgtacctaaaagaaacttaattccataaaacttg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7684259 |
agatgaagcaatagcatggataattaagatatctataatgaatgcatgcattaaaagacgattaaatgtacctaaaagaaacttaattccataaaacttg |
7684160 |
T |
|
| Q |
112 |
atttcgacactgctattaccacatctctagcgagtgcaagaaacaagatggaacaatttgttttttg-ttttaaaagatggatcaat |
197 |
Q |
| |
|
||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
7684159 |
attgcgacactgctattaccacatctctaacgagtgcaagaaacaagatggaacaatttgttttttgtttttacaagatggatcaat |
7684073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University