View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11296_high_5 (Length: 262)
Name: NF11296_high_5
Description: NF11296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11296_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 249
Target Start/End: Complemental strand, 10510680 - 10510457
Alignment:
| Q |
19 |
acaaacagtgtacaaaattgtcctgaacaacacatcttatcttatcttataatataaacaaatgaatgcacgcatggtttgtcaagaaataaaataaaga |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
10510680 |
acaaacagtgtacaaaattgtcatgaacaacacatcttatcttatcttataatataaataaatgaatgcacgcatggtttgtcaaaaaataaaataatga |
10510581 |
T |
 |
| Q |
119 |
tgaatgcatgcatgagagatgagacttattaatgaagttggtcattgatccatcgtagtcagtaatatctcagtttaggagcaacgtgtctcattgaagc |
218 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10510580 |
tgaatgcatgcatgaga-------cttattaatgaagttggtcattgatccatcgtagtcagtcatatctcagtttaggagcaacgtgtctcattgaagc |
10510488 |
T |
 |
| Q |
219 |
tttcgtgagtgtccttgtctctttgccattc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10510487 |
tttcgtgagtgtccttgtctctttgccattc |
10510457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University