View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11296_high_6 (Length: 258)
Name: NF11296_high_6
Description: NF11296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11296_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 50 - 243
Target Start/End: Original strand, 54302792 - 54302985
Alignment:
| Q |
50 |
aatttcaatgtaaagaaagagttaacacgatggcaactttagagcttgacattttgaaaaaagtaaagggtgatttcagaatnnnnnnngataaacctgt |
149 |
Q |
| |
|
||||| ||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54302792 |
aatttgaatgtaaagaaagagctaacactatggcaactttagagcttgacattctgaaaaaagtaaagggtgatttcagaataaaaaaagataaacctgt |
54302891 |
T |
 |
| Q |
150 |
atatatggagcaccgttcgccactttatacatgacaatcatgacttcctgctgcttccgtaacatttacagaaaaatgtcaccgcgttcatctc |
243 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
54302892 |
atatatggagcatcgttcgccactttatatatgacaatcatgacttcctgctgcttccgtaacatttacagaaaaatgtcaccacgttcatctc |
54302985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University