View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11298_low_16 (Length: 233)
Name: NF11298_low_16
Description: NF11298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11298_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 4023869 - 4023654
Alignment:
| Q |
1 |
tagtcatgtgtgagagactaggtctgagagagtatgtaaaataatattnnnnnnntacttttggtcctcatattaaattggtacgaaacagataacccga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
4023869 |
tagtcatgtgtgagagactaggtctgagagagtatataaaataatattaaaaaaatacttttggtcctcatattaaattgatacgaaacagataactcga |
4023770 |
T |
 |
| Q |
101 |
gag--caccctaattcggtctttatttcagttatgtacttgtcctataatatgttccnnnnnnncttttgatcggatcagatccgacccattgtgttagg |
198 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4023769 |
gagtacaccctaattcggtctttatttcagttatgtacttgtcctatattatgttcctttttttcttttgattggatcagatccgacccattgtgttagg |
4023670 |
T |
 |
| Q |
199 |
gttggacgggttgtaa |
214 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
4023669 |
gtcggacgggttgtaa |
4023654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University