View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11298_low_16 (Length: 233)

Name: NF11298_low_16
Description: NF11298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11298_low_16
NF11298_low_16
[»] chr2 (1 HSPs)
chr2 (1-214)||(4023654-4023869)


Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 4023869 - 4023654
Alignment:
1 tagtcatgtgtgagagactaggtctgagagagtatgtaaaataatattnnnnnnntacttttggtcctcatattaaattggtacgaaacagataacccga 100  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||       ||||||||||||||||||||||||| ||||||||||||||| |||    
4023869 tagtcatgtgtgagagactaggtctgagagagtatataaaataatattaaaaaaatacttttggtcctcatattaaattgatacgaaacagataactcga 4023770  T
101 gag--caccctaattcggtctttatttcagttatgtacttgtcctataatatgttccnnnnnnncttttgatcggatcagatccgacccattgtgttagg 198  Q
    |||  ||||||||||||||||||||||||||||||||||||||||||| ||||||||       |||||||| |||||||||||||||||||||||||||    
4023769 gagtacaccctaattcggtctttatttcagttatgtacttgtcctatattatgttcctttttttcttttgattggatcagatccgacccattgtgttagg 4023670  T
199 gttggacgggttgtaa 214  Q
    || |||||||||||||    
4023669 gtcggacgggttgtaa 4023654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University