View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11299_low_10 (Length: 284)
Name: NF11299_low_10
Description: NF11299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11299_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 162 - 279
Target Start/End: Original strand, 45811911 - 45812028
Alignment:
| Q |
162 |
aggaaagaatgaatgtaacggttgaattaacttctgcacattttcagcttctttagtgcttgatcagacttctcagagctagcgactctagagccagatc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45811911 |
aggaaagaatgaatgtaacggttgaattaacttctgcacattttcagcttctttagtgcttgatcagacttctcagagctagcgactctagagccagagc |
45812010 |
T |
|
| Q |
262 |
gcattttcctttgcttct |
279 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
45812011 |
gcattttcctttgattct |
45812028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 18 - 96
Target Start/End: Original strand, 45811767 - 45811845
Alignment:
| Q |
18 |
agagcctaaggatcccaacaaactaagacactacatgtacagtcaatctcatccatgctggataataatccagcacagg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45811767 |
agagcctaaggatcccaacaaactaagacactacatgtacagtcaatctcatccatgctggataataatccagcacagg |
45811845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University