View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11299_low_12 (Length: 250)
Name: NF11299_low_12
Description: NF11299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11299_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 71 - 190
Target Start/End: Complemental strand, 46408168 - 46408049
Alignment:
| Q |
71 |
atcaaaatattttattattgacgagttgatcatcacattagactcagagcaaccacacagaatttggcaccacaatttcatataaaatctaagatattgg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46408168 |
atcaaaatattttattattgacgagttgatcatcacattagactcaaagcaaccacacagaatttggcaccacaatttcatataaaatctaagatattgg |
46408069 |
T |
|
| Q |
171 |
ttatgtagatcttctcactt |
190 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
46408068 |
ttatgtagatcttctcactt |
46408049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University