View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11299_low_9 (Length: 316)
Name: NF11299_low_9
Description: NF11299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11299_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 11 - 302
Target Start/End: Original strand, 27327286 - 27327578
Alignment:
| Q |
11 |
cataggtattaaatacgctagaaaatagaattagggttcaaaattaaagacaaaatatatgaaatatgtttgtaattcttttcactaaattatcagtaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27327286 |
cataggtattaaatacgctagaaaatagaattagggttcaaaattaaagacaaaatatataaaatatgtttgtaattcttttcactaaattatcagtaag |
27327385 |
T |
|
| Q |
111 |
caaatatgaactgtctagtttgctttttaaattcttagatgttttgcaaacatactaaaggataactatacaccaaatcaagnnnnnnnnnnnnncagaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27327386 |
caaatatgaactgtctagtttgctttttaaattcttagatgttttgcaaacatactaaaggataactatacaccaaatcaagaaaaaaacaaaaacagaa |
27327485 |
T |
|
| Q |
211 |
tttcatataggcctaccaatgaaccaaaataaatagaaaaatgaactttcattta-nnnnnnngtagttgtaatttatgtatgtgttgtattt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27327486 |
tttcatataggcctaccaatgaaccaaaatcaataaaaaaatgaactttcatttattttttttgtagttgtaatttatgtatgtgttgtattt |
27327578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University