View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_high_27 (Length: 367)
Name: NF1129_high_27
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 88 - 360
Target Start/End: Complemental strand, 37138672 - 37138387
Alignment:
| Q |
88 |
ccaatgcattgctaacaagtgtttttaagaagctaaaaaag------------ttctaggtagaaaaagttaatatttaa-gttttaaggtgtgcatatt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| | |||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
37138672 |
ccaatgcattgctaacaagtgtttttaagaagctaaaaaacaaaattgataaattctagattgaaaaagtcaatttttaaagttttaaggtgtgcatatt |
37138573 |
T |
 |
| Q |
175 |
tgttaacatttccttaattatatatatagggatccaatttgaattagggatcaatttaagataagaacaaggcccctgctaccaagagacaaggcgagaa |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37138572 |
tgttaacatttccttaattatatatatagggatccaatttgaattaggggtcaatttaagataagaacaaggcccctgctaccaagagacaaggcgagaa |
37138473 |
T |
 |
| Q |
275 |
tataacctgctcctgttgtcttatatgttgatgactgccgagtttatgccttgcacttggctggccctctcattacccctatgata |
360 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37138472 |
tataacctgctcctgttgtcttatatattgatgactgccgagtttatgccttgcacttggctggccctctcattacccccatgata |
37138387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University