View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_high_33 (Length: 339)
Name: NF1129_high_33
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 30 - 335
Target Start/End: Original strand, 5565934 - 5566239
Alignment:
| Q |
30 |
atgtcctgagagaatttcagtagaaaaatcttacataatatgttgagattttatacctatcttcggttagcctgttaaagaaatggccaacgatcgatgg |
129 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
5565934 |
atgtcttgagagaattttagtagaaaaatcttacataatatgttgagattttatacctatcttcggttagcctgttaaagaaatggccaacagtcgacgg |
5566033 |
T |
 |
| Q |
130 |
gcaagttggccctgtcggagcaattaaataactgtttctttaattttattttttcaactgacacaannnnnnnnattggtaatttaattagtttggtatt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5566034 |
gcaagttggccctgtcggagcaattaaataactgcttctttaattttattttttcaactgacacaattttttttattggtaatttaattagtttggtatt |
5566133 |
T |
 |
| Q |
230 |
tgaatataaagttcatttttcacttcgttgttccatttcgttgtctattcttcctcctaagaaaggtcatgcttctcacacttccacttattcactctag |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5566134 |
tgaatataaagttcatttttcacttcgttgttccatttcgttgtctattcttcctcctaagaaaggtcatgcttctcacacttccacttattcactctag |
5566233 |
T |
 |
| Q |
330 |
ttcata |
335 |
Q |
| |
|
|||||| |
|
|
| T |
5566234 |
ttcata |
5566239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University