View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_high_39 (Length: 309)
Name: NF1129_high_39
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_high_39 |
 |  |
|
| [»] scaffold0211 (1 HSPs) |
 |  |  |
|
| [»] scaffold0114 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 5e-96; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 38 - 269
Target Start/End: Complemental strand, 42536157 - 42535930
Alignment:
| Q |
38 |
caacaatcacaagaaaaataatgcttacaatgaagcctgagaagaaacaataaaacctattccttttttatcatcagttggttggagttggaccagacat |
137 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42536157 |
caacaatcacaagacaaataatgcttacaatgaagcctgagaagaaacaataaaacctattccttttttatcattagttggttggagttggaccagacat |
42536058 |
T |
 |
| Q |
138 |
gaacatgaccatgtctgttacccgtataaatcgtgttcctggcggtcttcattataatagagggtggttataccctccaaagcctctgtaactgacannn |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42536057 |
gaacatgaccatgtctgttacccgtataaatcgcgttc----cggtcttcatcataatagagggtggttataccctccaaagcctctgtaactgacattt |
42535962 |
T |
 |
| Q |
238 |
nnnnagatgaatcaatgcactccaaagctttt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42535961 |
ttttagatgaatcaatgcactccaaagctttt |
42535930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 39 - 269
Target Start/End: Complemental strand, 42530454 - 42530214
Alignment:
| Q |
39 |
aacaatcacaagaaaaataatgcttacaatgaagcctgagaagaaacaataaaacctattccttttttatcatcagttggttggagttggaccagacatg |
138 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42530454 |
aacaatcacatgacaaataatgcttacaatgaagcctgagaagaaacaataaaacctattccttttttatcatcagttggttggagttggaccagacatg |
42530355 |
T |
 |
| Q |
139 |
aacatgaccatgtctgttacccgtataaatcgtgttcctggcggtcttca--------ttataatagagggtggttataccctccaaagcct------ct |
224 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||| ||||||||| | |||||||||||||||||||||||||||||||| || |
|
|
| T |
42530354 |
aacaagaccatgtctgttacccgtataaatcgcgttc----cggtcttcatcataaattcataatagagggtggttataccctccaaagcctctgggact |
42530259 |
T |
 |
| Q |
225 |
gtaactgacannnnnnnagatgaatcaatgcactccaaagctttt |
269 |
Q |
| |
|
| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42530258 |
ggaactgacattatttgagatgaatcaatgcactccaaagctttt |
42530214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 297
Target Start/End: Original strand, 314241 - 314273
Alignment:
| Q |
265 |
ctttttaaacatatggtgtcttcatttgatatt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
314241 |
ctttttaaacatatggtgtcttcatttgatatt |
314273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 265 - 297
Target Start/End: Original strand, 6554459 - 6554491
Alignment:
| Q |
265 |
ctttttaaacatatggtgtcttcatttgatatt |
297 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
6554459 |
ctttttaaatatatggtgtcttcatttgatatt |
6554491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0211 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0211
Description:
Target: scaffold0211; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 297
Target Start/End: Complemental strand, 18621 - 18589
Alignment:
| Q |
265 |
ctttttaaacatatggtgtcttcatttgatatt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
18621 |
ctttttaaacatatggtgtcttcatttgatatt |
18589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0114 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0114
Description:
Target: scaffold0114; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 297
Target Start/End: Original strand, 36958 - 36990
Alignment:
| Q |
265 |
ctttttaaacatatggtgtcttcatttgatatt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36958 |
ctttttaaacatatggtgtcttcatttgatatt |
36990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 297
Target Start/End: Original strand, 50241398 - 50241430
Alignment:
| Q |
265 |
ctttttaaacatatggtgtcttcatttgatatt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
50241398 |
ctttttaaacatatggtgtcttcatttgatatt |
50241430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 297
Target Start/End: Complemental strand, 31966009 - 31965977
Alignment:
| Q |
265 |
ctttttaaacatatggtgtcttcatttgatatt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31966009 |
ctttttaaacatatggtgtcttcatttgatatt |
31965977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 297
Target Start/End: Complemental strand, 45918396 - 45918364
Alignment:
| Q |
265 |
ctttttaaacatatggtgtcttcatttgatatt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45918396 |
ctttttaaacatatggtgtcttcatttgatatt |
45918364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 265 - 297
Target Start/End: Complemental strand, 41527198 - 41527166
Alignment:
| Q |
265 |
ctttttaaacatatggtgtcttcatttgatatt |
297 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
41527198 |
ctttttaaatatatggtgtcttcatttgatatt |
41527166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University