View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_high_42 (Length: 300)
Name: NF1129_high_42
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 66 - 276
Target Start/End: Original strand, 403704 - 403914
Alignment:
| Q |
66 |
ggattacctcgccggcggcgattcggttaacgactgattccgctaggcgttggattttgggtggcgactccatcttttacggtgtttgttgggttttgga |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
403704 |
ggattacctcgccggcggcgattcggttaacgaccgattccgctaggcgttgaattttgggtggcgattccatcttttacggtgtttgttgggttttgga |
403803 |
T |
 |
| Q |
166 |
gtgacgagaaatggaatttgttcgcgggagtatgaatgttgtactgggcgggagagagagaaggaatccatatcagtatttttccgggtcccaccgattc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
403804 |
gtgacgagaaatggaatttgttcgcgggagtatgaatgttgtactgggcgggagagagagaaggaatccatatcagtatttttccgggtcccaccgattc |
403903 |
T |
 |
| Q |
266 |
tagaaattaat |
276 |
Q |
| |
|
||||||||||| |
|
|
| T |
403904 |
tagaaattaat |
403914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University