View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_high_48 (Length: 280)
Name: NF1129_high_48
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_high_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 1114273 - 1114170
Alignment:
| Q |
1 |
tgagttgcaaccttgttgaaagtttaagggctttttcaggggacaacccacatgagtttatgagacttaacaatgtaaaggtgccacctttatgttgatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1114273 |
tgagttgcaaccttgttgaaagtttaagggctttttcaggggacaacccacatgagtttatgagacttaacaatgtaaaggtgtcacctttatgttgatc |
1114174 |
T |
|
| Q |
101 |
tgtg |
104 |
Q |
| |
|
|||| |
|
|
| T |
1114173 |
tgtg |
1114170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 94
Target Start/End: Original strand, 17377549 - 17377622
Alignment:
| Q |
21 |
agtttaagggctttttcaggggacaacccacatgagtttatgagacttaacaatgtaaaggtgccacctttatg |
94 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||| || | || || ||| |||||||||| |||||||||| |
|
|
| T |
17377549 |
agtttaagggctgtttcaggggacaactcacatgaattaacaaggtttgacactgtaaaggtgtcacctttatg |
17377622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University