View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1129_high_54 (Length: 258)

Name: NF1129_high_54
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1129_high_54
NF1129_high_54
[»] chr4 (1 HSPs)
chr4 (1-102)||(2260180-2260281)
[»] chr2 (1 HSPs)
chr2 (6-57)||(44733780-44733831)


Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 2260281 - 2260180
Alignment:
1 cattagtcactctttttgcaccaatgcttgagctgcttcccataaactgattcaaatcaatccccagtttcttatagtccataaactctctctccatcct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2260281 cattagtcactctttttgcaccaatgcttgagctgcttcccataaactgattcaaatcaatccccagtttcttatagtccataaactctctctccatcct 2260182  T
101 ga 102  Q
    ||    
2260181 ga 2260180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 6 - 57
Target Start/End: Original strand, 44733780 - 44733831
Alignment:
6 gtcactctttttgcaccaatgcttgagctgcttcccataaactgattcaaat 57  Q
    ||||||||||| |||||||||||||||||||| || || || ||||||||||    
44733780 gtcactcttttagcaccaatgcttgagctgctaccaatgaattgattcaaat 44733831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University