View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_high_61 (Length: 251)
Name: NF1129_high_61
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_high_61 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 13971174 - 13971411
Alignment:
| Q |
1 |
taaacaccactattgactaaaatcgttttcgaacatcgtataacacttaaaattacctcttgtcttaccctcgcgtatacttctttcatttgacagcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||| ||||||| ||| | | || ||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
13971174 |
taaacaccactattgactaaaatc---tccgaacatcttataacagttatagtcactccttgtcttacccttcggcatacttctttcatttgacagcttg |
13971270 |
T |
 |
| Q |
101 |
catctcttgttaactcaggttgtttcggttgttttggaaaactacggggatatcaaggaagattctcaaaatgggaattctacagggcgttattcatgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13971271 |
catctcttgttaactcaggttgtttcggttgttttggaaaattatggggatatcaaggaagattctcaaaacgggaattctacagggcgttattcatgga |
13971370 |
T |
 |
| Q |
201 |
gaatggtagtgaatgccaaaggagaactcaacgtgcctatg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13971371 |
gaatggtagtgaatgccaaaggagaactcaacgtgcctatg |
13971411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University