View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_low_32 (Length: 366)
Name: NF1129_low_32
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 196 - 353
Target Start/End: Complemental strand, 47201548 - 47201391
Alignment:
| Q |
196 |
caggttgggttggcaccactttgggatgatgggtatgggaatcgcactgttgaagattactttgctgcatccaaagagatttgcaagtttgatggtggcc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47201548 |
caggttgggttggcaccactttgggatgatgggtatgggaatcgcactgttgaagattactttgctgcatccaaagagatttgcaagtttgatggtggcc |
47201449 |
T |
 |
| Q |
296 |
caccacgttggttttgcccaatcgaatgtgcttctcctttccaaggttctcccaccct |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47201448 |
caccacgttggttttgcccaatcgaatgtgcttctcctttccaaggttctcccaccct |
47201391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 30 - 165
Target Start/End: Complemental strand, 47201720 - 47201579
Alignment:
| Q |
30 |
tcaagttcatcaatcacgtagcttagatatattgtcatctgaatctgatccattaaacggaacttcttcttct------gttgttgttgaaacaaaccaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47201720 |
tcaagttcatcaatcacgtagcttagatatattgtcatctgaatctgatccattaaacggaacttcttcttcttcttctgttgttgttgaaacaaaccaa |
47201621 |
T |
 |
| Q |
124 |
aacaaggttcctcttttattgcgttctactaataatgttgtt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47201620 |
aacaaggttcctcttttattgcgttctactaataatgttgtt |
47201579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University