View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_low_41 (Length: 327)
Name: NF1129_low_41
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_low_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 126 - 233
Target Start/End: Original strand, 6954293 - 6954400
Alignment:
| Q |
126 |
gttggattaatggacaggccaaattggaacgctttagttcataatatcaatccaaaagttcaaaccaatggactcgaatgctccaacacttataaacact |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6954293 |
gttggattaatggacaggccaaattggaacactttagttcataatatcaatccaaaagttcaaaccaatggactggaatgctccaacacttataaacact |
6954392 |
T |
|
| Q |
226 |
ttagtttt |
233 |
Q |
| |
|
|||||||| |
|
|
| T |
6954393 |
ttagtttt |
6954400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 6954190 - 6954258
Alignment:
| Q |
23 |
gtggttttcattgtgaattattgatgctttgacttcaaatctgttactcattacaagcaatcacagttc |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6954190 |
gtggttttcattgtgaattattgatgctttgacttcaaatctgttactcattacaagcaatcacagttc |
6954258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 176 - 233
Target Start/End: Complemental strand, 27837967 - 27837910
Alignment:
| Q |
176 |
tccaaaagttcaaaccaatggactcgaatgctccaacacttataaacactttagtttt |
233 |
Q |
| |
|
|||||||||||||| |||||||||| ||| ||||| ||||||||||||| |||||||| |
|
|
| T |
27837967 |
tccaaaagttcaaatcaatggactcaaattctccaccacttataaacaccttagtttt |
27837910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University