View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_low_49 (Length: 307)
Name: NF1129_low_49
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 32 - 226
Target Start/End: Complemental strand, 38931524 - 38931330
Alignment:
| Q |
32 |
atatgtatagaaatgtaggaacattacaacaagtttgtagccatatctgaattcagtagccgactttagtacacggtgttgtttgaatgcagatttctgg |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931524 |
atatgtatagaaatgtaggaacattacaacaagtttgtagccatatctgaattcagtagccgactttagtacacggtgttgtttgaatgcagatttctgt |
38931425 |
T |
|
| Q |
132 |
atctccttctcatcctatttgaattgaagcaagcagtgagtaacaaagacaggaccaacatacataaccaagaaaacaaatcctcagcgtgatga |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931424 |
atctccttctcatcctatttgaattgaagcaagcagtgagtaacaaagacaggaccaacatacataaccaagaaaacaaatcctcagcgtgatga |
38931330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University