View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1129_low_51 (Length: 300)

Name: NF1129_low_51
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1129_low_51
NF1129_low_51
[»] chr3 (1 HSPs)
chr3 (66-276)||(403704-403914)


Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 66 - 276
Target Start/End: Original strand, 403704 - 403914
Alignment:
66 ggattacctcgccggcggcgattcggttaacgactgattccgctaggcgttggattttgggtggcgactccatcttttacggtgtttgttgggttttgga 165  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||    
403704 ggattacctcgccggcggcgattcggttaacgaccgattccgctaggcgttgaattttgggtggcgattccatcttttacggtgtttgttgggttttgga 403803  T
166 gtgacgagaaatggaatttgttcgcgggagtatgaatgttgtactgggcgggagagagagaaggaatccatatcagtatttttccgggtcccaccgattc 265  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
403804 gtgacgagaaatggaatttgttcgcgggagtatgaatgttgtactgggcgggagagagagaaggaatccatatcagtatttttccgggtcccaccgattc 403903  T
266 tagaaattaat 276  Q
    |||||||||||    
403904 tagaaattaat 403914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University