View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_low_58 (Length: 285)
Name: NF1129_low_58
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_low_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 153 - 264
Target Start/End: Original strand, 2260180 - 2260291
Alignment:
| Q |
153 |
tcaggatggagagagagtttatggactataagaaactggggattgatttgaatcagtttatgggaagcagctcaagcattggtgcaaaaagagtgactca |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2260180 |
tcaggatggagagagagtttatggactataagaaactggggattgatttgaatcagtttatgggaagcagctcaagcattggtgcaaaaagagtgactaa |
2260279 |
T |
|
| Q |
253 |
tgtctgtgttgc |
264 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2260280 |
tgtctgtgttgc |
2260291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 198 - 249
Target Start/End: Complemental strand, 44733831 - 44733780
Alignment:
| Q |
198 |
atttgaatcagtttatgggaagcagctcaagcattggtgcaaaaagagtgac |
249 |
Q |
| |
|
|||||||||| || || || |||||||||||||||||||| ||||||||||| |
|
|
| T |
44733831 |
atttgaatcaattcattggtagcagctcaagcattggtgctaaaagagtgac |
44733780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University