View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_low_63 (Length: 280)
Name: NF1129_low_63
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_low_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 1114249 - 1114333
Alignment:
| Q |
1 |
aaactttcaacaaggttgcaactcataaaccctaatggcccaaatgctgttattcaacttttcagaagctatggtttctctgatt |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1114249 |
aaactttcaacaaggttgcaactcataaaccctaatggcccaaatgctgttattcaacttttcagaagctatggtttctctgatt |
1114333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 13 - 85
Target Start/End: Complemental strand, 17377541 - 17377469
Alignment:
| Q |
13 |
aggttgcaactcataaaccctaatggcccaaatgctgttattcaacttttcagaagctatggtttctctgatt |
85 |
Q |
| |
|
|||||| ||| || ||||||||||| |||||||||||||||||||||| | || | ||||||||| ||||||| |
|
|
| T |
17377541 |
aggttgaaacccaaaaaccctaatgccccaaatgctgttattcaacttctaaggaactatggtttttctgatt |
17377469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University