View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_low_64 (Length: 279)
Name: NF1129_low_64
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_low_64 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 58 - 279
Target Start/End: Complemental strand, 18668698 - 18668480
Alignment:
| Q |
58 |
ttgtttgtttggctattattgtggaatagattgcctgctgaggacaatttacaaacatcgtattattccacaagatgctcagctttgtgtgagtgggtgc |
157 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
18668698 |
ttgtttgtttggctattattgcggaatagattgccta---aggacaatttacaaacatcgtattattccacaagatgttcagctttgtgtggatgggtgc |
18668602 |
T |
|
| Q |
158 |
agtcatttagaatctgcggctcacccattttctgaattgtattgtgtttggatcgttgtggtattacgtgcttcggtggctaagctttgtttcggcctcc |
257 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18668601 |
ggtcactaagaatctgcggctcacccattttctgaattgtattgtgtttggatcgttgtggtattacgtgcttcggtggctaagctttgtttcggcctcc |
18668502 |
T |
|
| Q |
258 |
ccgtatgttgtttccgatcatt |
279 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
18668501 |
ccgtatgttgtttccgatcatt |
18668480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 140 - 216
Target Start/End: Complemental strand, 36390163 - 36390088
Alignment:
| Q |
140 |
ctttgtgtgagtgggtgcagtcatttagaatctgcggctcacccattttctgaattgtattgtgtttggatcgttgt |
216 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | ||| || ||||||||||||| ||||||||||||||||| |
|
|
| T |
36390163 |
ctttgtgtgagtgggtgcggtcatttagaatctgcagatca-cctttttctgaattgtcctgtgtttggatcgttgt |
36390088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University