View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_low_65 (Length: 278)
Name: NF1129_low_65
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_low_65 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 40 - 222
Target Start/End: Complemental strand, 30639500 - 30639318
Alignment:
| Q |
40 |
attctaggtttcataaaatcattactccaaaagatcttatatctgttgggcattttacatgaacttaacctgaactcgtcctcagtgggttatcatgagt |
139 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30639500 |
attctaggtgtcataaaatcattactccaaaagatcttatatctgttgggcattttacatgaacttaacctgaactcgtcctcagtgggttatcatgagt |
30639401 |
T |
 |
| Q |
140 |
aatgacttaaacttgacccgcgataaacttgtgtggtcaatattgaagatgcatgctgtaatttatcaattgaacctaacctg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30639400 |
aatgacttaaacttgacccgcgataaacttgtgtggtcaatattgaagatgcatgctgtaatttatcaattgaacctaacctg |
30639318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University