View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_low_69 (Length: 259)
Name: NF1129_low_69
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_low_69 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 29 - 254
Target Start/End: Complemental strand, 42192407 - 42192182
Alignment:
| Q |
29 |
aactacgtcgtcttgagaaacaaaacctattttgcgtttcatgcaggatgagtctgagtttccgttgtatgttattgttccggtgacttttccggcaagt |
128 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
42192407 |
aactacatcgtcttgagaaacaaaacctattttgcgtttcatgcaggatgagtctgagtttccgttgtatgttatggttccagtgacttttccggcaagt |
42192308 |
T |
 |
| Q |
129 |
cttccggctaaggccgttagtagggtggttttgccgctccctgagggtcctagcattgctgttaactcgccgggtcttgctactccagtgactccgttga |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42192307 |
cttccggctaaggccgttagtagggtggttttgccactccctgagggtcctaacattgctgttaactcgccgggtcttgctactccggtgactccgttga |
42192208 |
T |
 |
| Q |
229 |
ggatttttcttgttacctttgtttct |
254 |
Q |
| |
|
|||||||||||||||| |||| |||| |
|
|
| T |
42192207 |
ggatttttcttgttacttttgattct |
42192182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University