View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_low_70 (Length: 258)
Name: NF1129_low_70
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_low_70 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 2260281 - 2260180
Alignment:
| Q |
1 |
cattagtcactctttttgcaccaatgcttgagctgcttcccataaactgattcaaatcaatccccagtttcttatagtccataaactctctctccatcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2260281 |
cattagtcactctttttgcaccaatgcttgagctgcttcccataaactgattcaaatcaatccccagtttcttatagtccataaactctctctccatcct |
2260182 |
T |
|
| Q |
101 |
ga |
102 |
Q |
| |
|
|| |
|
|
| T |
2260181 |
ga |
2260180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 6 - 57
Target Start/End: Original strand, 44733780 - 44733831
Alignment:
| Q |
6 |
gtcactctttttgcaccaatgcttgagctgcttcccataaactgattcaaat |
57 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || || || |||||||||| |
|
|
| T |
44733780 |
gtcactcttttagcaccaatgcttgagctgctaccaatgaattgattcaaat |
44733831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University