View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_low_75 (Length: 252)
Name: NF1129_low_75
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_low_75 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 26492002 - 26491764
Alignment:
| Q |
1 |
aaaatgattatgtaaattttactaagcttttagatattgttttgagttgacaccattcatgtatgtattgcagttagagaagcagaagaactagactggg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
26492002 |
aaaatgattatgtaaattttactaagcttttagatattgttttaagttg-caccattcatgtatatattgcagttagagaagcagaagagctagactggg |
26491904 |
T |
 |
| Q |
101 |
gaatgagaaagaggatagctatgggaatagcttactgtctagaccacatgcatcaactcacaccacccatttcccacagaaatctgttatcttcttctat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26491903 |
gaatgagaaagaggatagctatgggaatagcttactgtctagaccacatgcataatctcacaccacccatttcccacagaaatctgttatcttcttctat |
26491804 |
T |
 |
| Q |
201 |
atacctcactgaagattatgctgctaaaatatcagacctt |
240 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26491803 |
atacctaactgaagattatgctgctaaaatatcagacctt |
26491764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University