View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1129_low_81 (Length: 251)

Name: NF1129_low_81
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1129_low_81
NF1129_low_81
[»] chr3 (1 HSPs)
chr3 (30-214)||(20385670-20385857)


Alignment Details
Target: chr3 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 30 - 214
Target Start/End: Complemental strand, 20385857 - 20385670
Alignment:
30 gctttctaaatgcacacgcagtagtgtgtat--atatgtggtacggctgtgttgaattcttagcaattgaaatttaatcaaaaagccagcaacagtaatt 127  Q
    ||||||||||||||||||||||||||||| |  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20385857 gctttctaaatgcacacgcagtagtgtgtgtgtatatgtggtacggctgtgttgaattcttagcaattgaaatttaatcaaaaagccagcaacagtaatt 20385758  T
128 aataatacgagcaaaactaaatatatggca-tagcaatggcagcgtgaatgaaaaggaaaaaacaaagggaaattagagtttggaatt 214  Q
    ||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20385757 aataatacgagcaaaactagatatatggcattagcaatggcagcgtgaatgaaaaggaaaaaacaaagggaaattagagtttggaatt 20385670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University