View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1129_low_81 (Length: 251)
Name: NF1129_low_81
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1129_low_81 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 30 - 214
Target Start/End: Complemental strand, 20385857 - 20385670
Alignment:
| Q |
30 |
gctttctaaatgcacacgcagtagtgtgtat--atatgtggtacggctgtgttgaattcttagcaattgaaatttaatcaaaaagccagcaacagtaatt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20385857 |
gctttctaaatgcacacgcagtagtgtgtgtgtatatgtggtacggctgtgttgaattcttagcaattgaaatttaatcaaaaagccagcaacagtaatt |
20385758 |
T |
 |
| Q |
128 |
aataatacgagcaaaactaaatatatggca-tagcaatggcagcgtgaatgaaaaggaaaaaacaaagggaaattagagtttggaatt |
214 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20385757 |
aataatacgagcaaaactagatatatggcattagcaatggcagcgtgaatgaaaaggaaaaaacaaagggaaattagagtttggaatt |
20385670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University