View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11300_high_15 (Length: 247)
Name: NF11300_high_15
Description: NF11300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11300_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 41 - 228
Target Start/End: Complemental strand, 51706793 - 51706606
Alignment:
| Q |
41 |
gtaccgaatcaagtagaaggagtagggggtggaggaacaacagtagccgttgaagatgcatcagcagaaatgacaattgtaaaatcaggaggcagtggtg |
140 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51706793 |
gtaccgaatcaagtagaaggagtaggaggcggaggaacaacagtagccgttgaagatgcatcagcaggaatgacaattgtaaaatcaggaggcagtggtg |
51706694 |
T |
|
| Q |
141 |
gcaacggagcatactctgttggtttccgattcctatctgacagtgatgattttctgggcctcgtcttcatgtgatgtgcagttgattt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51706693 |
gcaacggagcatactctgttggtttccgattcctatccgacagtgatgattttctgggtctcgtcttcatgtgatgtgcagttgattt |
51706606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University