View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11300_high_17 (Length: 237)
Name: NF11300_high_17
Description: NF11300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11300_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 218
Target Start/End: Complemental strand, 49702622 - 49702421
Alignment:
| Q |
17 |
acatatatggttatgtacgtttgtgtctttgttcatgcaaggaaagaaaatctacaaaccagtgctgttcttccattcctgtctgtttcatttggatctg |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49702622 |
acatatatggttatgtacgtttgtgtatttgttcatgcaaggaaagaaaatccacaaaccagtgctgttcttccattcctgtctgtttcatttggatctg |
49702523 |
T |
|
| Q |
117 |
agcccttcttcagcaaccgttgtaacagtcgtttgtcacttctgcctgctgcaaagcatgtgctgataggtagatccgttttaccacgagccaacatggc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49702522 |
agcccttcttcagcaaccgttgtaacagtcgtttgtcacttctgcctgctgcaaagcatgtgctgataggtagatctgttttaccacgagccaacatggc |
49702423 |
T |
|
| Q |
217 |
ct |
218 |
Q |
| |
|
|| |
|
|
| T |
49702422 |
ct |
49702421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University