View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11300_low_16 (Length: 250)

Name: NF11300_low_16
Description: NF11300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11300_low_16
NF11300_low_16
[»] chr1 (1 HSPs)
chr1 (1-171)||(15800657-15800830)


Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 15800657 - 15800830
Alignment:
1 taatatatccgatgtgggacatacaaatgctcagacaagtgaagcaaggtggtataattttgagtgaaacagtatccacctaagatgctcagtcatatta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||||||||||||||    
15800657 taatatatccgatgtgggacatacaaatgctcagacaagtgaagcaagatgatataattttgagtaaaacagtatccacctaagatgctcagtcatatta 15800756  T
101 tttggttctaattgaaaacaactcatgcatgcatatt---gtaaaccagtatcttctgttttattttattgttc 171  Q
    |||||||||||||||||||||||||||||||||||||   ||||||||||||||||| ||||||||||||||||    
15800757 tttggttctaattgaaaacaactcatgcatgcatatttcagtaaaccagtatcttctattttattttattgttc 15800830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University