View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11300_low_16 (Length: 250)
Name: NF11300_low_16
Description: NF11300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11300_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 15800657 - 15800830
Alignment:
| Q |
1 |
taatatatccgatgtgggacatacaaatgctcagacaagtgaagcaaggtggtataattttgagtgaaacagtatccacctaagatgctcagtcatatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15800657 |
taatatatccgatgtgggacatacaaatgctcagacaagtgaagcaagatgatataattttgagtaaaacagtatccacctaagatgctcagtcatatta |
15800756 |
T |
|
| Q |
101 |
tttggttctaattgaaaacaactcatgcatgcatatt---gtaaaccagtatcttctgttttattttattgttc |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
15800757 |
tttggttctaattgaaaacaactcatgcatgcatatttcagtaaaccagtatcttctattttattttattgttc |
15800830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University