View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11300_low_7 (Length: 321)
Name: NF11300_low_7
Description: NF11300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11300_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 19 - 310
Target Start/End: Original strand, 1786204 - 1786495
Alignment:
| Q |
19 |
gttaggtaaggtctataaaggtacaatgaaaaataatcagcaagttgcagtgaagcacataatcaatgatgatggaaatatagaaacttttgtgagagaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1786204 |
gttaggtaaggtctataaaggtacaatgaaaaataatcagcaagttgcagtgaagcacataatcaatgatgatggaaatatagaaacttttgtgagagaa |
1786303 |
T |
 |
| Q |
119 |
gttacaagtctatctcatgtcaagcaccaaaatcttgtttctttgcttggctgttgtgttgatggagatgaatgtcttcttatctatgaactatgtccaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1786304 |
gttacaagtctatctcatgtcaagcaccaaaatcttgtttctttgcttggctgttgtgttgatggagatgaatgtcttcttatctatgaactatgtccaa |
1786403 |
T |
 |
| Q |
219 |
atggaagtctttcagaatggctatttggtaattaannnnnnnnaagtacttattgtggcatgagagtttgaaattttgtttactcttttctt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1786404 |
atggaagtctttcagaatggctatttggtaattaattttttttaagtacttattgtggcatgagagtttgaaattttgtttactcttttctt |
1786495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University