View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11301_high_31 (Length: 301)
Name: NF11301_high_31
Description: NF11301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11301_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 32042573 - 32042288
Alignment:
| Q |
1 |
tgacacaatatagttttctcttcccttcactttcagccatagaatgcatttaacatccgaagtagtgagtc------ctacttctgaaggccatcgtttg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32042573 |
tgacacaatatagttttctcttcccttcactttcagccatagaatgcatttaacatccgaagtagtgagtctgagtcctacttctgaaggccatcgtttg |
32042474 |
T |
 |
| Q |
95 |
gtcccgaccgtgcccacaccatacataactcctt-gggcccaatggtggcactcagctcaagagttttgtcttagaagacaaataacaatattaattcat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32042473 |
gtcccgaccgtgcccacaccatacataactcctttgggcccaatggtggcactcagctcaagagttttgtcttagaagacaaataacaatattaattaat |
32042374 |
T |
 |
| Q |
194 |
ttgtttacaatatgcatcatatttcaaccttatactaaattttcaatgatcatataaattatttcgcattggaatcaagttgtggg |
279 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32042373 |
ttgtttacaatatgcatcatgcttcaaccttatactaaattttcaatgatcatataaattatttcgcattggaatcaagttgtggg |
32042288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University