View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11301_high_43 (Length: 238)

Name: NF11301_high_43
Description: NF11301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11301_high_43
NF11301_high_43
[»] chr5 (1 HSPs)
chr5 (64-222)||(26568699-26568853)


Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 64 - 222
Target Start/End: Original strand, 26568699 - 26568853
Alignment:
64 ttttagtcttggatcccctacagcggctgcatggcgcagtagttgtggggatcgttagatctggagagcgagagagaatctaacgatccccatagttgtt 163  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||    
26568699 ttttagtcttggatcccctacagcggctgcatggcgcagtagttgtggggatcgttagatctggagag----agagaatctaacgatccccatagttgtt 26568794  T
164 ttatgggatacactcttgcaagtgtaggacggggtttaattttccttaataactctctt 222  Q
    ||| ||||||||||||||||||||||||  ||||||||||||||| |||||||||||||    
26568795 ttacgggatacactcttgcaagtgtagggtggggtttaattttccctaataactctctt 26568853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University