View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11301_high_45 (Length: 230)
Name: NF11301_high_45
Description: NF11301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11301_high_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 9938624 - 9938409
Alignment:
| Q |
1 |
acagattgcagatagtatgacttggcctttgaagctggaaaccttttgcaaattgagggagaaactaggcatctgtgaaatgtcttaattctttgtgata |
100 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9938624 |
acagattgcagatattatgacttggcttttgaagctggaaaccttttgcaaattgagggagaaactaggcatctgtgaaatgtcttaattctttgtgata |
9938525 |
T |
 |
| Q |
101 |
tatgtttgtaaactaaatttgtttgtcataaggttcagtttaggagagtgattgttaggatatgcttgttacaagttagttagaagttagttgtggaagt |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9938524 |
tatgtctgtaaactaaatttgtttgtcataaggttcagtttaggagagtaattgttaggatatgcttgttacaagttagttagaagttagttgtggaagt |
9938425 |
T |
 |
| Q |
201 |
tacttagctctcaagt |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
9938424 |
tacttagctctcaagt |
9938409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University