View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11301_high_47 (Length: 227)
Name: NF11301_high_47
Description: NF11301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11301_high_47 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 41885284 - 41885056
Alignment:
| Q |
1 |
atattacaaact-aaagtcattcaactggtccattttaactaagaacgtgagacaatataaacaatattggtcttcgtcttcctttacaatgtgagactt |
99 |
Q |
| |
|
|||||||||||| ||| |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41885284 |
atattacaaacttaaaatcattcaattggtccattgtaactaagaacgtgagacaatataaacaatattggtcttcgtcttcctttacaatgtgagactt |
41885185 |
T |
 |
| Q |
100 |
gtttcaaagatttttcattttagcaatctacaccttaattgaaaattatatatcttttgctttcattgtctacgggtagttcgaaagaactatcatattg |
199 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41885184 |
gtttcaaagatttttcattttagtaatctacaccttaattgaaaattatatatcttttgctttcattgtctacgggtagttcgaaagaactatcatattg |
41885085 |
T |
 |
| Q |
200 |
taattgtaac-aaaagaatatactttact |
227 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
41885084 |
taattgtaacaaaaagaatatactttact |
41885056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University