View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11301_high_55 (Length: 203)
Name: NF11301_high_55
Description: NF11301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11301_high_55 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 5e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 4 - 188
Target Start/End: Complemental strand, 33250895 - 33250711
Alignment:
| Q |
4 |
atgaaccggatgcgggttgggcttgttttgtggggacacaataggaaaattttgttattttagcttgagaagggaaaccaagacgaccaagattcattcc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33250895 |
atgaaccggatgcgggttgggcttgttttgtggggacacaataggaaaattttgttattttagcttgagaagggaaaccaagacgaccaagattcattcc |
33250796 |
T |
|
| Q |
104 |
caaaatacccctagcatcatctgattgagtagcgcaaccaaggatgatgggaggggtagtttgggaaggagagaaagcaattttt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33250795 |
caaaatacccctagcatcatctgattgagtagcgcaaccgaggatgatgggaggggtagtttgggaaggagagaaagcaattttt |
33250711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 36 - 184
Target Start/End: Complemental strand, 33264955 - 33264807
Alignment:
| Q |
36 |
gggacacaataggaaaattttgttattttagcttgagaagggaaaccaagacgaccaagattcattcccaaaatacccctagcatcatctgattgagtag |
135 |
Q |
| |
|
|||||| |||| || ||||| ||||||||||||||| |||||| || |||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
33264955 |
gggacaaaataagagaatttggttattttagcttgattagggaaggagaggcgaccaagattcattcccaaaatacccctagcatcatcggattgattag |
33264856 |
T |
|
| Q |
136 |
cgcaaccaaggatgatgggaggggtagtttgggaaggagagaaagcaat |
184 |
Q |
| |
|
| ||||| ||||| || |||||||||||| |||||||||| |||||||| |
|
|
| T |
33264855 |
cacaaccgaggataataggaggggtagttagggaaggagataaagcaat |
33264807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University