View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11301_low_26 (Length: 344)
Name: NF11301_low_26
Description: NF11301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11301_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 52153176 - 52153026
Alignment:
| Q |
1 |
agtgtttaaggaaggctggtggtgggttggcaggttggtgtgtttctgcaggggtgttctttcaagctgctgcctggtgtagtttggagttatcaatgcc |
100 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52153176 |
agtgtttaagggaggctggtgttgggttggcaggttggtgtgtttctgcaggggtgttctttcaagctgctgcctggtgtagtttggagttatcaatgcc |
52153077 |
T |
|
| Q |
101 |
ttgtttttatgccgtagagagtctggcgtgggttctgtagttggccgattc |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52153076 |
ttgtttttatgccgtagagagtctggcgtgggttctgtagttggccgattc |
52153026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 202 - 333
Target Start/End: Complemental strand, 52152979 - 52152848
Alignment:
| Q |
202 |
atttggtagagttttagcttttaggtattgatattgttcttagcctctggtgttgtaggttgcaattttctgcttatatacggaactgttctggttgtat |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52152979 |
atttggtagagttttagcttttaggtattgatattgttcttagcctctggtggtgtaggttgcaaatttctgcttatatacggaactgttctggttgtat |
52152880 |
T |
|
| Q |
302 |
tcgtcagtcgcaagtccagttaatatattctt |
333 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |
|
|
| T |
52152879 |
tcgtctgtcgcaagtccagttaatatattctt |
52152848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University