View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11301_low_43 (Length: 239)
Name: NF11301_low_43
Description: NF11301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11301_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 8339352 - 8339463
Alignment:
| Q |
1 |
gaactcgagcttactctcttttgcgacgaagatgctcccggcttcaagctaccgcaagccctcttctcatgccctaatctagtttcactcaggcatgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8339352 |
gaactcgagcttactctcttttgcgacgaagatgctcccgacttcaagctaccgcaagccctcttctcatgccctaatctagtttcactcaggcatgcat |
8339451 |
T |
 |
| Q |
101 |
gcactcacgcac |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8339452 |
gcactcacgcac |
8339463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 8339531 - 8339573
Alignment:
| Q |
180 |
tgtccttcaatatttgtttggaatgaagaaccagacacaaata |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8339531 |
tgtccttcaatatttgtttggaatgaagaaccagacacaaata |
8339573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University