View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11301_low_43 (Length: 239)

Name: NF11301_low_43
Description: NF11301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11301_low_43
NF11301_low_43
[»] chr5 (2 HSPs)
chr5 (1-112)||(8339352-8339463)
chr5 (180-222)||(8339531-8339573)


Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 8339352 - 8339463
Alignment:
1 gaactcgagcttactctcttttgcgacgaagatgctcccggcttcaagctaccgcaagccctcttctcatgccctaatctagtttcactcaggcatgcat 100  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8339352 gaactcgagcttactctcttttgcgacgaagatgctcccgacttcaagctaccgcaagccctcttctcatgccctaatctagtttcactcaggcatgcat 8339451  T
101 gcactcacgcac 112  Q
    ||||||||||||    
8339452 gcactcacgcac 8339463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 8339531 - 8339573
Alignment:
180 tgtccttcaatatttgtttggaatgaagaaccagacacaaata 222  Q
    |||||||||||||||||||||||||||||||||||||||||||    
8339531 tgtccttcaatatttgtttggaatgaagaaccagacacaaata 8339573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University