View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11301_low_44 (Length: 238)
Name: NF11301_low_44
Description: NF11301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11301_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 64 - 222
Target Start/End: Original strand, 26568699 - 26568853
Alignment:
| Q |
64 |
ttttagtcttggatcccctacagcggctgcatggcgcagtagttgtggggatcgttagatctggagagcgagagagaatctaacgatccccatagttgtt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26568699 |
ttttagtcttggatcccctacagcggctgcatggcgcagtagttgtggggatcgttagatctggagag----agagaatctaacgatccccatagttgtt |
26568794 |
T |
 |
| Q |
164 |
ttatgggatacactcttgcaagtgtaggacggggtttaattttccttaataactctctt |
222 |
Q |
| |
|
||| |||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
26568795 |
ttacgggatacactcttgcaagtgtagggtggggtttaattttccctaataactctctt |
26568853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University