View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11301_low_45 (Length: 238)
Name: NF11301_low_45
Description: NF11301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11301_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 224
Target Start/End: Original strand, 4112289 - 4112496
Alignment:
| Q |
16 |
agacaatttttataatgaatagttttaagtatatggaagtgattattgattaaatataatcacatgtgtcggtctcatgatcattatgcattagacacca |
115 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4112289 |
agacaatttttataatga-tagttttaagtatatggaagtgattattgattaaatataatcacatgtgtcggtctcatgatcattatgcattagacacca |
4112387 |
T |
 |
| Q |
116 |
aacacgttctcgatctgcagtgtcgatgctacatcataaataaataatatttgcacgttcaatgttaaaagcctttaattatttatgctgactcttactt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4112388 |
aacacgttctcgatctgcagtgtcgatgctacatcataaataaataatatttgcacgttcaatgttaaaagcctttaattatttatgctgactcttactt |
4112487 |
T |
 |
| Q |
216 |
ttttatttt |
224 |
Q |
| |
|
||||||||| |
|
|
| T |
4112488 |
ttttatttt |
4112496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University