View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11301_low_50 (Length: 226)
Name: NF11301_low_50
Description: NF11301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11301_low_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 39380147 - 39380331
Alignment:
| Q |
1 |
atacaacatacctctaaatagagatgttagaaaaattggtttacaaagggggagaacaagcaacggttaagcaatcacttacacacatatttttctccaa |
100 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||| | |||||| | | |||||||||||| ||||||||||||||||| |||||||||||| ||| |
|
|
| T |
39380147 |
atacaacatacctctaaacagagatgtcagaaaaactagtttacgacgagggagaacaagcgacggttaagcaatcact----cacatatttttc--caa |
39380240 |
T |
 |
| Q |
101 |
atttgatattctatcttaaagcttatacatatgcttaagattagcttatgattattgtatcataaatatttttaatggaatgaacaacgtc |
191 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39380241 |
atttgatattctatcttagagcttatacatatgcttaagattagcttatgattattgtatcataaatatttttaatggaatgaacaacgtc |
39380331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University