View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11301_low_52 (Length: 223)
Name: NF11301_low_52
Description: NF11301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11301_low_52 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 11 - 202
Target Start/End: Complemental strand, 31207814 - 31207623
Alignment:
| Q |
11 |
agcaaaggaggcatcgattttgaggtgctctgctatgaaattcattgttataaaaacaacattattgtaacatattgaatgttgtagtatatgttgtaaa |
110 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31207814 |
agcaaaggagacatcaattttgaggtgctctgctatgaaatccattgttataaaaacaacgttattgtaacatattgaatgttgtagtatatgttgtaaa |
31207715 |
T |
|
| Q |
111 |
attacaagggaagaaaccgttttaaatattcacttgcaaaacaagaaagccactctatattccacactttgatggctaatttgcttaagcta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31207714 |
attacaagggaagaaaccgttttaaatattcacttgcaaaacaagaaagccactccatattccacactttgatggctaatttgcttaagcta |
31207623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University