View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11302_low_7 (Length: 389)
Name: NF11302_low_7
Description: NF11302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11302_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 99 - 341
Target Start/End: Complemental strand, 38841114 - 38840872
Alignment:
| Q |
99 |
taatttcttgatttatgattttgccagggtttataatttttggtgtaatgaactgatattgagtctgttgatatatgattccgctatggtttttcatgtt |
198 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38841114 |
taatttcttgatttatgattttgctagggtttataatttttggtgtaatgaactgatattgagtctgttgatatatgattctgctatggtttttcatgtt |
38841015 |
T |
 |
| Q |
199 |
tggtgtaatgaattgaaatttttgtatatttgataatattttggtatatgctcaatcggtgaatcaattttgatgcatacaatgtagaatcaccgccgac |
298 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38841014 |
tggtgtaatgaattgaagtttttgtatatttgataatattttgttatatactcaatcggtgactcaattttgatgcatacaatgtagaatcaccgccgac |
38840915 |
T |
 |
| Q |
299 |
atctgtttgattctannnnnnnggattaaggatcttgttatgg |
341 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| |
|
|
| T |
38840914 |
atctgtttgattttatttttttggattaaggatcttgttatgg |
38840872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 359 - 389
Target Start/End: Complemental strand, 38840854 - 38840824
Alignment:
| Q |
359 |
gaatgaaatgaacataaattttggtttattt |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38840854 |
gaatgaaatgaacataaattttggtttattt |
38840824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 289
Target Start/End: Complemental strand, 9876342 - 9876281
Alignment:
| Q |
229 |
tgataatattttggtatatgctcaat-cggtgaatcaattttgatgcatacaatgtagaatc |
289 |
Q |
| |
|
|||||||||||||||||||||||||| |||| || ||||| |||||||||||||||||| |
|
|
| T |
9876342 |
tgataatattttggtatatgctcaataaggtgcctccattttagtgcatacaatgtagaatc |
9876281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University