View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11303_high_4 (Length: 324)
Name: NF11303_high_4
Description: NF11303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11303_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 2 - 310
Target Start/End: Complemental strand, 37727279 - 37726972
Alignment:
| Q |
2 |
acaaaacaatataaatgtagttgttaagtatatccaagattggaatttaacgttttcactagcataacttctgcgggtattgaaacacattaactaaata |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37727279 |
acaaaacaatataaatgtagttgttaagtatatccaagattggaatttaacgttttcactagcataacttctgcgggtattgaaacacattaactaaata |
37727180 |
T |
 |
| Q |
102 |
aactaaataagttagaccttctagctgctttcatgatgttcttgttgttgccgttgtttttgtcagtgttttagatttatggcgnnnnnnngtattgcag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37727179 |
aactaaataagttagaccttctagctgctttcatgatgttcttgttgttg-cgttgtttttgtcagtgttttagatttatggcgtttttttgtattgcag |
37727081 |
T |
 |
| Q |
202 |
atccatgtctggtttgtggttctgttacttagcatgcaaatttattcctttttgtctttcattcttttctggannnnnnnncctgaaattggaatccgat |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
37727080 |
atccatgtctggtttgtggttctgttacttagcatgcaaatttattcctttttgtcttccattcttttctggattttttttcctgaaattggaatccgat |
37726981 |
T |
 |
| Q |
302 |
gtgtttcat |
310 |
Q |
| |
|
||||||||| |
|
|
| T |
37726980 |
gtgtttcat |
37726972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 203 - 274
Target Start/End: Original strand, 34809817 - 34809888
Alignment:
| Q |
203 |
tccatgtctggtttgtggttctgttacttagcatgcaaatttattcctttttgtctttcattcttttctgga |
274 |
Q |
| |
|
|||||| | ||||||||| ||||||| | |||||| |||||||||||||||||| | |||| ||||||||| |
|
|
| T |
34809817 |
tccatgaccggtttgtgggtctgttattgagcatgaaaatttattcctttttgttgtacatttttttctgga |
34809888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University