View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11305_high_11 (Length: 324)
Name: NF11305_high_11
Description: NF11305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11305_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 14 - 309
Target Start/End: Complemental strand, 36565927 - 36565630
Alignment:
| Q |
14 |
agacgtgtttggctgtgaattggaatttcaggttttccatggtttttatcagcaacccacactatttaatcatttaactgaggtagctaataatatcata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36565927 |
agacgtgtttggctgtgaattggaatttcaggttttccatggttgttatcaacaacccacactatttaatcatttaactgaggtagctaataatatcata |
36565828 |
T |
 |
| Q |
114 |
ggtaccattgtatgcaatggttacaaatgttagtttttgcggtgctttggttcactgcaaaatgnnnnnnnnaggattcatagcaaaattatagaacgag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36565827 |
ggtaccattgtatgcaatggttacaaatgttagtttttgcggtgctttggttcactgcaaaatgttttttttaggattcatagcaaaattatagaacgag |
36565728 |
T |
 |
| Q |
214 |
attaccttaaatggatgggttttactcttaactttatttatgaatgtcagtttatatatacaaata--tttggttagtattttattagctgtccaatt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||| |
|
|
| T |
36565727 |
attaccttaaatggatgggttttactcttaactttatttatgaatgtcagtttatatatacaaatatttttggttagtattttaatagttgtccaatt |
36565630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University