View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11305_high_13 (Length: 258)
Name: NF11305_high_13
Description: NF11305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11305_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 24 - 235
Target Start/End: Original strand, 34563518 - 34563729
Alignment:
| Q |
24 |
tcaggtccaccgggacttaatctttgaagctcgtcacgttttccaccttcttcttttgcaaatggttgtatggaattccaattccaatgagaagttgcta |
123 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34563518 |
tcaggtccaccgggacttaatctttgtagctcgtcacgttttccaccttcttcttctggaaatggttgtatggaattccaattccaatgagaagttgcta |
34563617 |
T |
 |
| Q |
124 |
acatgtgatgatcacttaccattgttgggttcaaatgtcgtgtctcacctccaccacttagaaccaacactaacaaaatgcaacccaaaattctcgtttc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34563618 |
acatgtgatgatcacttaccattgttgggttcagatgtcgtgtctcacctctaccacatagaaccaacactaacaaaatgcaactcaaaattctcgtttc |
34563717 |
T |
 |
| Q |
224 |
tttggtcattct |
235 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34563718 |
tttggtcattct |
34563729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University