View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11305_low_5 (Length: 450)
Name: NF11305_low_5
Description: NF11305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11305_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 292
Target Start/End: Original strand, 43770548 - 43770824
Alignment:
| Q |
20 |
atgaatgattcaaggtgagttcaatttttattatcatttaaacatgaattaagttgtttctttacttcaaccnnnnnnngataattcagttattaatttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43770548 |
atgaatgattcaaggtgagttcaatttttattatcatttaaacatgaattaagttgtttctttacttcaaccaaaaaaagataattcagttattaatttt |
43770647 |
T |
|
| Q |
120 |
tatagt---ttttagcagaagttaaggcggcaaatgtgaattgtgatgtaagatgat-atatttgttgcatgcattcaagaatcaactttttattagatc |
215 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43770648 |
tatagtagtttttagcagaagataaggcggcaaatgtgaattgtgatgtaagatgattatatttgttgcatgcattcaagaatcaactttttattagatc |
43770747 |
T |
|
| Q |
216 |
tgatctgatcatccaaaatctattcaagtctggatctgcgcattcatccactgtttcataattggaaagcactcata |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43770748 |
tgatctgatcatccaaaatctattcaagtctggatctgcgcattcatctactgtttcataattggaaagcactcata |
43770824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University