View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11306_high_12 (Length: 231)

Name: NF11306_high_12
Description: NF11306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11306_high_12
NF11306_high_12
[»] chr5 (1 HSPs)
chr5 (19-186)||(18161058-18161225)


Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 19 - 186
Target Start/End: Complemental strand, 18161225 - 18161058
Alignment:
19 cctgtgtgaatgtgttcaccaagatgattctgtcagcggtggaatcttccgtggcatgggaatcggaactatgatctgggttggtgttgtttgaagatga 118  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||    
18161225 cctgtgtgaatgtgttcaccaagatgattctgtcagtggtggaatcttccgtggcatgggaatcggaactatgatctgggtctgtgttgtttgaagatga 18161126  T
119 atgtgaaaggcttaacattctgatcgttctttcgaacagagaagaaatttcagcttctaaagccatcg 186  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||    
18161125 atgtgaaaggcttaacattctgatcattctttcgaacagagaagaaatttctgcttctaaagccatcg 18161058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University