View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11306_high_14 (Length: 209)

Name: NF11306_high_14
Description: NF11306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11306_high_14
NF11306_high_14
[»] chr4 (1 HSPs)
chr4 (15-160)||(14984886-14985031)


Alignment Details
Target: chr4 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 15 - 160
Target Start/End: Complemental strand, 14985031 - 14984886
Alignment:
15 aacctgtgtgggtcttaattttgcgtttgctgcaacgtgttcctgcacaaactgcactgcagactgagccaatctaattgggtctgttggagtactatta 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||    
14985031 aacctgtgtgggtcttaattttgcgtttgctgcaacgtgttcctgcacaaactgcactgcagactgagccaatctgattgggtctgttggagtaccatta 14984932  T
115 aacacagcctgattcctagcataccagactttccacagaattgtac 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
14984931 aacacagcctgattcctagcataccagactttccacagaattgtac 14984886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University